FiltersDone

Question type

Essay

Multiple Choice

Short Answer

True False

Matching

Exam 20: Genomics and Proteomics

Show Answer

Share

---

All types

Filters

Study Flashcards

Question 41

Essay

Review LaterAdd Note

Review Later

How has metagenomics of ocean samples contributed to our understanding of energy in biological systems?

Correct Answer

Answered by ExamLex AI

Metagenomics of ocean samples has greatl...

View Answer

Show Answer

Question 42

Multiple Choice

Review LaterAdd Note

Review Later

Use the following to answer questions The following microarray data are shown for four human genes. Two samples were hybridized to the microarray in this experiment. One sample was cDNA generated from mRNA of a tissue culture cell line that was originally derived from a B-cell leukemia. The other sample was cDNA generated from normal, mature neural tissue. $\bullet$ Vertical stripes mean hybridization to cancerous B-cell cDNA only. $\bullet$ Horizontal stripes mean hybridization to normal neural cell cDNA only. $\bullet$ Completely filled in means hybridization to both cDNA types. $\bullet$ Blank means hybridization to neither cell's cDNA. -The gene sequences contained in spot 2 are present only in the B-cell cancer sample. What is a possible function for this gene, based on the microarray data?

A) This gene may be involved in neurotransmitter release at the synapse since B-cells are known to be involved in cell-to-cell signaling.
B) This gene may be involved in activating cell growth, so it is switched on in the cancer cell line that is growing rapidly.
C) This gene is involved in the immune function of the B-cell since that is the cell type from which this cancer line was initially derived.
D) This gene may be involved in neurotransmitter release at the synapse or in activating cell growth.
E) This gene may be involved in activating cell growth or in the immune function of the B-cell.

F) D) and E)
G) B) and C)

Correct Answer

verified

Show Answer

Question 43

Multiple Choice

Review LaterAdd Note

The study of the expression, localization, and interactions of the complete set of proteins found in a given cell is called:

For a physical map of a chromosome, distances are measured in units of:

A section of a genome is cut with three enzymes: A, B, and C. Cutting with A and B yields a 10-kb fragment. Cutting with B and C yields a 2-kb fragment. What is the expected result from a digest with A and C, if the C site lies in between the A and B sites?

Which of the following is NOT a reason that metagenomics is particularly useful for studying microbes?

Two-dimensional polyacrylamide gel electrophoresis (2D-PAGE) is a technique wherein proteins are separated in one dimension by a chemical property and in a second dimension by a different property. -By what property are proteins separated in the second dimension?

You've cloned a 2-kb fragment of DNA into a bacterial cloning vector and want to construct a restriction map of the insert. You amplify the 2-kb insert using PCR, purify it, and subject it to differential digestion with the enzymes EcoRI and HindIII, gel-fractionate the digests, and visualize the restriction patterns by staining the gels with ethidium bromide to generate the following results. -Using these data, which two loci would be closest on a genetic map if the frequency of crossing over is equal in this region? $\begin{array} { l l } & \text { Restriction fragment lengths } \\\hline\text { EcoRI } & 350 \mathrm { bp } , 500 \mathrm { bp } , 1250 \mathrm { bp } , 100 \mathrm { bp } \\\text { HindIII } & 350 \mathrm { bp } , 650 \mathrm { bp } , 1000 \mathrm { bp } \\\text { EcoRI/HindIII } & 100 \mathrm { bp } , 150 \mathrm { bp } , 200 \mathrm { bp } , 300 \mathrm { bp } , 350 \mathrm { bp } , 900 \mathrm { bp }\end{array}$

Short regions of chromosome 1 were sequenced in a population of Drosophila. These sequences from three different flies are shown below. Identify the SNP haplotype for Fly #3. Fly #1: 5ʹ ATGGCACGAAGCTAAGAATA 3ʹ Fly #2: 5ʹ ATGGCTCGACGCTCATAATA 3ʹ Fly #3: 5ʹ ATGGCGCGATGCTAAGAATC 3ʹ

You've cloned a 2-kb fragment of DNA into a bacterial cloning vector and want to construct a restriction map of the insert. You amplify the 2-kb insert using PCR, purify it, and subject it to differential digestion with the enzymes EcoRI and HindIII, gel-fractionate the digests, and visualize the restriction patterns by staining the gels with ethidium bromide to generate the following results. -Using these data, indicate the order of restriction sites in the DNA insert. $\begin{array} { l l } & \text { Restriction fragment lengths } \\\hline\text { EcoRI } & 350 \mathrm { bp } , 500 \mathrm { bp } , 1250 \mathrm { bp } , 100 \mathrm { bp } \\\text { HindIII } & 350 \mathrm { bp } , 650 \mathrm { bp } , 1000 \mathrm { bp } \\\text { EcoRI/HindIII } & 100 \mathrm { bp } , 150 \mathrm { bp } , 200 \mathrm { bp } , 300 \mathrm { bp } , 350 \mathrm { bp } , 900 \mathrm { bp }\end{array}$

Below are the steps involved in the RNA-seq process. Place these steps in the CORRECT order. 1. Conversion of the RNA to cDNA 2) Fragmentation and preparation of the cDNAs for sequencing 3) Isolation of the RNA molecules of interest from cells 4) Assembly of the sequencing reads into RNA transcripts 5) Sequencing of the cDNA

What role might segmental duplication play in evolution?

Two-dimensional polyacrylamide gel electrophoresis (2D-PAGE) is a technique wherein proteins are separated in one dimension by a chemical property and in a second dimension by a different property. - By what property are proteins separated in the first dimension?

Which of the following is a disadvantage of map-based sequencing over shotgun sequencing?

Which of the following statements about prokaryotic genomes is FALSE?

Compare orthologs and paralogs. Include one feature they have in common and one way in which they are different.

If a restriction enzyme cuts a circular DNA into three fragments, how many restriction sites are there in the DNA?

Explain why the greatest diversity of human SNPs is found among African populations.

The genome of the rice plant was completely sequenced in 2002. What features of the rice genome make it useful for sequencing efforts in other grass species, such as wheat and corn?