Question 1

You are working on an insulin-binding protein from fish. The beginning of the coding sequence of the gene is shown below. You find a mutant in the gene that cannot bind insulin (also shown below-the mutation is set in boldface type). Among a population of fish having the gene for the mutant protein, you find one that produces a variant of this protein that can now bind insulin again (DNA sequence also shown below). What kind of mutation is this new variant? (Use a genetic rather than a biochemical classification.) Original sequence: atgtgtcctatgtgagttgcggcttgttg
Mutant sequence: atg g tgtcctatgtgagttgcggctgttg
Variant sequence: atg g tgtcctatgtgagttgcggcttg g tg

Accepted Answer

The original sequence provided is:

atgt...

Question 2

A company has invented a new low-calorie sugar substitute and wants to determine if the substitute might be carcinogenic, so researchers use it in the Ames test. The results show no increase in mutant bacterial colonies. They then perform feeding experiments in laboratory rats and find a significant increase in the incidence of cancer. Offer an explanation for why the Ames test did not accurately predict the carcinogenic potential of the sugar substitute and suggest a solution to the problem.

Accepted Answer

The discrepancy between the results of t...

Question 3

Why do disruptive DNA lesions, like deletions and insertions, sometimes not lead to frameshift mutations?

Accepted Answer

Disruptive DNA lesions such as deletions...

Question 4

A geneticist is studying a mutation in a population of turtles that causes their shells to become extremely brittle. She determines the mutation is caused by the loss of two nucleotides in the coding region of a gene. Upon studying the mutant protein that is produced, she observes that it is 312 amino acids in length, as compared to the normal protein that is 588 amino acids in length. This mutant protein can no longer carry out its normal function of assisting in the Difficultening of a turtle's shell. Which of the following could NOT describe this mutation?

Accepted Answer

A)   deletion
B)   loss-of-function mutation
C)   transversion
D)   frameshift mutation
E)   nonsense mutationF) A) and B)
G) A) and C)

Question 5

Most transposable elements are flanked by direct DNA repeats. What is the significance of these direct repeats?

Accepted Answer

The direct DNA repeats flanking most tra...

Question 6

Suppose that you identify a mutation in a gene caused by a single base substitution. Which of the following would be the BEST choice to use in an attempt to reverse this mutation?

Accepted Answer

A)   UV light
B)   ethidium bromide
C)   hydroxylamine
D)   acridine orange
E)   EMSF) B) and C)
G) C) and E) E

Question 7

Ultraviolet light causes what type of DNA lesion?

Accepted Answer

A)   large deletions
B)   deaminated cytosines
C)   pyrimidine dimers
D)   mismatched bases
E)   depurinationsF) A) and B)
G) A) and C)

Question 8

Which of the following transposable elements are flanked by direct repeats of a short portion of the host genome?

Accepted Answer

A)   Tn10
B)   L1
C)   Activator (Ac) 
D)   Alu
E)   All of the answers are correct.F) A) and B)
G) C) and D)

Question 9

A single base substitution caused the amino acid sequence Met-His-Glu-Cys to be changed to Met-His. Which of the following describes the type of mutation that caused this change?

Accepted Answer

A)   transition mutation
B)   transversion mutation
C)   translesion mutation
D)   nucleotide deletion
E)   strand slippageF) C) and D)
G) A) and D)

Question 10

Which of the following types of mutations does NOT lead to a change in the amino acid sequence of the gene product?

Accepted Answer

A)   missense mutation
B)   nonsense mutation
C)   neutral mutation
D)   silent mutation
E)   loss-of-function mutationF) B) and E)
G) B) and C)

Question 11

A scientist discovers a mutant gene in which a nucleotide was deleted. Which of the following chemicals could potentially reverse this mutation?

Accepted Answer

A)   ethidium bromide
B)   hydroxylamine
C)   5-bromouracil
D)   EMS
E)   nitrous acidF) A) and B)
G) D) and E)

Question 12

What do alkylating agents do?

Accepted Answer

A)   They cause pyrimidine dimers.
B)   They add methyl or ethyl groups to bases.
C)   They oxidize guanine.
D)   They deaminate cytosine.
E)   All of the answers are correct.F) D) and E)
G) A) and B)

Question 13

Which of the following pairs of DNA repair systems will repair pyrimidine dimers in E. coli?

Accepted Answer

A)   mismatch repair and base-excision repair
B)   photoreactivation and mismatch repair
C)   nucleotide-excision repair and base-excision repair
D)   photoreactivation and nucleotide-excision repair
E)   nonhomologous end joining and nucleotide-excision repairF) D) and E)
G) B) and E) D

Question 14

Upon transposing to a new site, transposable elements:

Accepted Answer

A)   add methyl groups to bases of the surrounding DNA.
B)   delete about 100 base pairs of DNA on each side of them.
C)   duplicate their transposase gene.
D)   express a gene that confers sensitivity to some common antibiotics.
E)   create a duplication of a target sequence on each side of them.F) A) and B)
G) B) and D)

Question 15

Explain how transposable elements might play a role in studying gene function.

Accepted Answer

Transposable elements, also known as tra...

Question 16

The following sequence represents the DNA template strand of a gene:  a. Give the sequence of the mRNA transcribed from this DNA strand and, using the genetic code provided in Figure 15.12, give the amino acid sequence of the protein it encodes.

b. Give the amino acid sequence of the protein encoded by this sequence after the following mutations have occurred:
- a transition at nucleotide #10
- a transition at nucleotide #12
- atransition at nucleotide #7
- an insertion of a "G" immediately following nucleotide #10

Accepted Answer

The answer of The following sequence represents the DNA template...

Question 17

A polypeptide has the following amino acid sequence: Met-Ala-Gln-Arg-Glu-Leu. This polypeptide was mutated to produce the following mutant sequence: Met-Ala-Gln-Gly-Glu-Leu. Which describes the MOST likely type of mutation that occurred?

Accepted Answer

A)   nonsense mutation
B)   missense mutation
C)   frameshift mutation
D)   in-frame mutation
E)   neutral mutationF) A) and C)
G) A) and B)

Question 18

A codon for the amino acid serine undergoes a transversion so that it now codes for threonine. A transversion at a different site in the same codon then suppresses the first mutation. Give the nucleotides in the original codon, the transition mutation, and the transversion suppressor. (Note: There are two possible answers.)

Accepted Answer

Serine is coded by several codons: UCU, ...

Question 19

Hybrid dysgenesis in Drosophila occurs:

Accepted Answer

A)   when a male and a female, each carrying a copia element, mate and produce offspring that have numerous mutations.
B)   in the offspring of a cross between a male that carries a copia element and a female that carries a P element.
C)   in the offspring of a cross between a male that carries a Ty element and a female that carries an Ac element.
D)   in the offspring of a cross between a male that carries a P element and a female that does not carry a P element.
E)   in the offspring of a cross between a male that carries an Alu element and a female that carries a Ty element.F) A) and E)
G) A) and B)

Question 20

Which of the following statements describes the possible parasitic nature of transposable elements?

Accepted Answer

A)   Transposable elements can increase in number within genomes without providing an advantage to the host.
B)   Transposable elements are collected within their genomes by host organisms so that the host will benefit but not the transposable elements.
C)   Transposable elements will provide an evolutionary advantage to host organisms by transposing as often as possible.
D)   Transposable elements will enhance their expression of transposase so that the hosts can evolve more quickly.
E)   Transposable elements will add methyl groups to their own DNA to reduce their own rate of transposition.F) A) and D)
G) A) and E) A

Exam 18: Gene Mutations and Dna Repair

Correct Answer
Answered by ExamLex AI
The original sequence provided is:

atgt...
View Answer

Correct Answer
Answered by ExamLex AI
The discrepancy between the results of t...
View Answer

Why do disruptive DNA lesions, like deletions and insertions, sometimes not lead to frameshift mutations?

Correct Answer
Answered by ExamLex AI
Disruptive DNA lesions such as deletions...
View Answer

Correct Answer
verified

Most transposable elements are flanked by direct DNA repeats. What is the significance of these direct repeats?

Correct Answer
Answered by ExamLex AI
The direct DNA repeats flanking most tra...
View Answer

Suppose that you identify a mutation in a gene caused by a single base substitution. Which of the following would be the BEST choice to use in an attempt to reverse this mutation?

Correct Answer
verified
E

Ultraviolet light causes what type of DNA lesion?

Correct Answer
verified

Which of the following transposable elements are flanked by direct repeats of a short portion of the host genome?

Correct Answer
verified

A single base substitution caused the amino acid sequence Met-His-Glu-Cys to be changed to Met-His. Which of the following describes the type of mutation that caused this change?

Correct Answer
verified

Which of the following types of mutations does NOT lead to a change in the amino acid sequence of the gene product?

Correct Answer
verified

A scientist discovers a mutant gene in which a nucleotide was deleted. Which of the following chemicals could potentially reverse this mutation?

Correct Answer
verified

What do alkylating agents do?

Correct Answer
verified

Which of the following pairs of DNA repair systems will repair pyrimidine dimers in E. coli?

Correct Answer
verified
D

Upon transposing to a new site, transposable elements:

Correct Answer
verified

Explain how transposable elements might play a role in studying gene function.

Correct Answer
Answered by ExamLex AI
Transposable elements, also known as tra...
View Answer

Correct Answer
verified

A polypeptide has the following amino acid sequence: Met-Ala-Gln-Arg-Glu-Leu. This polypeptide was mutated to produce the following mutant sequence: Met-Ala-Gln-Gly-Glu-Leu. Which describes the MOST likely type of mutation that occurred?

Correct Answer
verified

Correct Answer
Answered by ExamLex AI
Serine is coded by several codons: UCU, ...
View Answer

Hybrid dysgenesis in Drosophila occurs:

Correct Answer
verified

Which of the following statements describes the possible parasitic nature of transposable elements?

Correct Answer
verified
A

Exam 18: Gene Mutations and Dna Repair

Correct AnswerAnswered by ExamLex AIThe original sequence provided is:atgt...View AnswerShow Answer

Correct AnswerAnswered by ExamLex AIThe discrepancy between the results of t...View AnswerShow Answer

Why do disruptive DNA lesions, like deletions and insertions, sometimes not lead to frameshift mutations?

Correct AnswerAnswered by ExamLex AIDisruptive DNA lesions such as deletions...View AnswerShow Answer

Correct AnswerverifiedShow Answer

Most transposable elements are flanked by direct DNA repeats. What is the significance of these direct repeats?

Correct AnswerAnswered by ExamLex AIThe direct DNA repeats flanking most tra...View AnswerShow Answer

Suppose that you identify a mutation in a gene caused by a single base substitution. Which of the following would be the BEST choice to use in an attempt to reverse this mutation?

Correct AnswerverifiedE

Ultraviolet light causes what type of DNA lesion?

Correct AnswerverifiedShow Answer

Which of the following transposable elements are flanked by direct repeats of a short portion of the host genome?

Correct AnswerverifiedShow Answer

A single base substitution caused the amino acid sequence Met-His-Glu-Cys to be changed to Met-His. Which of the following describes the type of mutation that caused this change?

Correct AnswerverifiedShow Answer

Which of the following types of mutations does NOT lead to a change in the amino acid sequence of the gene product?

Correct AnswerverifiedShow Answer

A scientist discovers a mutant gene in which a nucleotide was deleted. Which of the following chemicals could potentially reverse this mutation?

Correct AnswerverifiedShow Answer

What do alkylating agents do?

Correct AnswerverifiedShow Answer

Which of the following pairs of DNA repair systems will repair pyrimidine dimers in E. coli?

Correct AnswerverifiedD

Upon transposing to a new site, transposable elements:

Correct AnswerverifiedShow Answer

Explain how transposable elements might play a role in studying gene function.

Correct AnswerAnswered by ExamLex AITransposable elements, also known as tra...View AnswerShow Answer

Correct AnswerverifiedShow Answer

A polypeptide has the following amino acid sequence: Met-Ala-Gln-Arg-Glu-Leu. This polypeptide was mutated to produce the following mutant sequence: Met-Ala-Gln-Gly-Glu-Leu. Which describes the MOST likely type of mutation that occurred?

Correct AnswerverifiedShow Answer

Correct AnswerAnswered by ExamLex AISerine is coded by several codons: UCU, ...View AnswerShow Answer

Hybrid dysgenesis in Drosophila occurs:

Correct AnswerverifiedShow Answer

Which of the following statements describes the possible parasitic nature of transposable elements?

Correct AnswerverifiedA

Correct Answer
Answered by ExamLex AI
The original sequence provided is:

atgt...
View Answer

Correct Answer
Answered by ExamLex AI
The discrepancy between the results of t...
View Answer

Correct Answer
Answered by ExamLex AI
Disruptive DNA lesions such as deletions...
View Answer

Correct Answer
verified

Correct Answer
Answered by ExamLex AI
The direct DNA repeats flanking most tra...
View Answer

Correct Answer
verified
E

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified
D

Correct Answer
verified

Correct Answer
Answered by ExamLex AI
Transposable elements, also known as tra...
View Answer

Correct Answer
verified

Correct Answer
verified

Correct Answer
Answered by ExamLex AI
Serine is coded by several codons: UCU, ...
View Answer

Correct Answer
verified

Correct Answer
verified
A