Filters
Question type

Study Flashcards

List four characteristics required of genetic material. For each characteristic, indicate how the structure of DNA helps us to understand the characteristic.

Correct Answer

Answered by ExamLex AI

Answered by ExamLex AI

1. Stability: The structure of DNA, with...

View Answer

Which term CORRECTLY describes the molecule below? Which term CORRECTLY describes the molecule below?   A)  thymine base B)  purine base C)  pyrimidine base D)  nucleotide E)  amino acid


A) thymine base
B) purine base
C) pyrimidine base
D) nucleotide
E) amino acid

F) B) and C)
G) A) and E)

Correct Answer

verifed

verified

Which diagram shows a nucleotide with a purine base? Which diagram shows a nucleotide with a purine base?   A)  diagram A B)  diagram B C)  diagram C D)  diagram D E)  diagram E


A) diagram A
B) diagram B
C) diagram C
D) diagram D
E) diagram E

F) C) and D)
G) A) and B)

Correct Answer

verifed

verified

How did Alfred Hershey and Martha Chase contribute to our understanding of DNA?


A) used X-ray diffraction to examine the structure of DNA
B) determined that DNA contains four different nitrogenous bases
C) found that "the transforming principle" is destroyed by enzymes that hydrolyze DNA
D) found that the phosphorus-containing components are the genetic material of phages
E) discovered "the transforming principle" that could genetically alter bacteria

F) A) and B)
G) D) and E)

Correct Answer

verifed

verified

Two double-stranded fragments of DNA are exactly the same length. At 89°C, fragment A has completely denatured, which means that the two strands have separated. At that temperature, fragment B is still double stranded. How might these fragments differ to result in different denaturation temperatures?

Correct Answer

Answered by ExamLex AI

Answered by ExamLex AI

Fragment A and Fragment B, despite being...

View Answer

In eukaryotic DNA, regions called "CpG islands" are often associated with unusual gene expression patterns, particularly decreased expression. What could be different about the DNA structure in these regions to account for decreased gene expression?


A) methylated cytosine
B) methylated guanine
C) methylated phosphate
D) a triple-stranded region

E) A) and B)
F) None of the above

Correct Answer

verifed

verified

The bonds that connect nucleotides in a single strand are called _____ bonds.


A) phosphodiester
B) peptide
C) ionic
D) hydrogen
E) glycosidic

F) C) and D)
G) All of the above

Correct Answer

verifed

verified

Which secondary structure of DNA would MOST likely be seen in a dehydrated tissue sample?


A) A
B) B
C) Z
D) H

E) B) and C)
F) A) and D)

Correct Answer

verifed

verified

In the following DNA molecule, how many 3´ hydoxyls are present? AATAGCGGATGCCCGAATACGAG TTATCGCCTACGGGCTTATGCTC


A) 4
B) 2
C) 0
D) 24

E) A) and B)
F) B) and C)

Correct Answer

verifed

verified

Summarize the evidence that RNA serves as the genetic material in tobacco mosaic virus (TMV).

Correct Answer

Answered by ExamLex AI

Answered by ExamLex AI

The evidence that RNA serves as the gene...

View Answer

Draw the complementary strand to the following single-stranded DNA and label the 5' and 3'ends: 5'-ATAGCATGGGCCATACGATTACTGA-3'.

Correct Answer

Answered by ExamLex AI

Answered by ExamLex AI

The complementary strand to the given si...

View Answer

Which hypothesis contributed to the mistaken idea that protein is the genetic material because, with its 20 different amino acids, protein structure could be more variable than that of DNA?


A) tetranucleotide hypothesis
B) central dogma hypothesis
C) RNA world hypothesis
D) one gene-one enzyme hypothesis
E) adaptor hypothesis

F) All of the above
G) C) and D)

Correct Answer

verifed

verified

You are a researcher studying the genetic basis of colon cancer. You have been working with a colon cancer cell line to determine the expression levels of different genes that might contribute to cancer formation. You obtain the DNA methylation status of five genes of interest (the data are shown in the table below) . The plus (+) sign indicates the level of DNA methylation; more plus signs correlates with increased methylation levels.  Gene  Methylation levels 1++2+++++3+++4++5+\begin{array} { | l r r | } \hline \text { Gene } & \text { Methylation levels } & \\\hline 1 & + + \\\hline 2 & + + + + + \\\hline 3 & + + + \\4 & + + \\5 & +\end{array} Based on the information shown above, which gene would you predict to have the lowest rate of transcription?


A) gene 1
B) gene 2
C) gene 3
D) gene 4
E) gene 5

F) B) and D)
G) A) and E)

Correct Answer

verifed

verified

What type of secondary structure is formed by the pairing of three strands of DNA?


A) A-DNA
B) B-DNA
C) C-DNA
D) H-DNA
E) Z-DNA

F) B) and D)
G) A) and B)

Correct Answer

verifed

verified

A high-resolution X-ray diffraction technique was used to obtain detailed secondary structure of a DNA molecule. The characteristics of the DNA showed it was a left-handed helix with a general shape that was longer and narrower than the classic Watson-Crick model of DNA. Which form of DNA was resolved?


A) A-DNA
B) B-DNA
C) Z-DNA
D) H-DNA
E) single-stranded DNA

F) A) and D)
G) All of the above

Correct Answer

verifed

verified

List at least four errors in this drawing of two deoxyribonucleotides in a phosphodiester bond. List at least four errors in this drawing of two deoxyribonucleotides in a phosphodiester bond.

Correct Answer

verifed

verified

While doing research on deep-sea vents, you discover a very simple new life form. After some initial analysis, you find that this life form contains small fragments of DNA, small complementary RNA fragments, and proteins. Fortuitously, you collected two strains, one that is purple and one that is yellow. What experiments would you perform to determine which of these three cellular constituents serves as the genetic material in your new organism?

Correct Answer

Answered by ExamLex AI

Answered by ExamLex AI

To determine which of the three cellular...

View Answer

Which diagram shows a nucleotide that would be used to make RNA? Which diagram shows a nucleotide that would be used to make RNA?   A)  diagram A B)  diagram B C)  none of these diagrams D)  diagram D E)  diagram E


A) diagram A
B) diagram B
C) none of these diagrams
D) diagram D
E) diagram E

F) All of the above
G) A) and B)

Correct Answer

verifed

verified

Which DNA modification is the addition of a -CH3 group?


A) triple strand
B) methylation
C) looping
D) cytosine substitution
E) hydroxylation

F) A) and B)
G) A) and C)

Correct Answer

verifed

verified

What would be the sequence of an RNA produced by using the DNA sequence shown as a template? 3'-TACCGTGCGTGACATTAAGCC-5' Write the sequence from 5' to 3', left to right.

Correct Answer

Answered by ExamLex AI

Answered by ExamLex AI

To determine the sequence of an RNA stra...

View Answer

Showing 21 - 40 of 82

Related Exams

Show Answer