Filters
Question type

Study Flashcards

A diploid fungal cell is homozygous for a (TTG)5 trinucleotide repeat at a particular locus (see sequence below).During meiosis, an unequal crossover occurs at this locus between the second and third repeats on one homolog and between the third and fourth on the other.How many TTG repeats will each of the meiotic products have? (Assume that this species makes tetrads.) ATGTTGTTGTTGTTGTTGTGA

Correct Answer

verifed

verified

Two products (nonrecombinant)w...

View Answer

Which of the following enzyme activities is NOT a part of nucleotide-excision repair?


A) DNA polymerase
B) DNA ligase
C) Reverse transcriptase
D) DNA helicase
E) All of the answers are part of nucleotide-excision repair.

F) A) and B)
G) A) and C)

Correct Answer

verifed

verified

How can spontaneous mutations arise?

Correct Answer

verifed

verified

They can arise through natural consequen...

View Answer

A scientist created a new auxotrophic mutant of bacteria that is leu- for a new Ames test.In order for the mutant to grow in the absence of leucine, a(n) _____ mutation would have to occur in the _____ gene.


A) missense; leu-
B) intragenic reversion; leu-
C) nonsense; leu-
D) intergenic reversion; leu-
E) silent; leu-

F) A) and E)
G) B) and D)

Correct Answer

verifed

verified

Explain how transposable elements might play a role in studying gene function.

Correct Answer

verifed

verified

Because some transposable elements inser...

View Answer

Suppose a research study shows that people who suffer from severe depression are homozygous for a mutation in the hypothetical DEP gene.Individuals without this form of depression have the following sequence at the beginning of the translated region of their DEP genes 5'-ATG ACG TTT GAA ATT CAG TCT AGA-3'(MET THR PHE GLU ILE GLN SER ARG) .Affected individuals have the following sequence 5'-ATG ACG TTT GAA ATT TAG TCT AGA-3'(MET THR PHE GLU ILE STOP) .The mutation identified is most likely a:


A) missense.
B) gain of function.
C) nonsense.
D) frameshift.
E) deletion.

F) B) and D)
G) B) and C)

Correct Answer

verifed

verified

Which of the following statements about an animal bearing a somatic mutation is TRUE?


A) Some, but not all, of the animal's offspring will also carry the mutation.
B) All of the animal's offspring will carry the mutation.
C) Both the animal and its offspring will show the mutant trait.
D) The animal but not its offspring can be affected by the mutation.
E) The gametes produced by the animal will all carry the mutation.

F) B) and D)
G) B) and E)

Correct Answer

verifed

verified

Which of the following pairs of sequences would you expect to be found in the same transposable element?


A) Inverted repeats and a gene for transposase
B) Long-terminal repeats and a gene for transposase
C) Inverted repeats and a gene for reverse transcriptase
D) A gene for transposase and a gene for reverse transcriptase
E) Both long-terminal repeats and a gene for transposase AND inverted repeats and a gene for reverse transcriptase are correct.

F) A) and E)
G) A) and D)

Correct Answer

verifed

verified

_____ mutations produce new activities and are usually dominant.


A) Induced
B) Spontaneous
C) Forward
D) Gain-of-function
E) Lethal

F) None of the above
G) B) and C)

Correct Answer

verifed

verified

Transposable elements that transpose through an RNA intermediate are retrotransposons.There are two types of retrotransposons, those that have direct repeats at each end, often called long terminal repeats (LTRs), and those that do not have these repeats.Pick an example of each type of retrotransposon and give: (1)its basic structure, and (2)its possible evolutionary history.

Correct Answer

verifed

verified

A prominent example of the first type of...

View Answer

Assume that you discovered a new chemical mutagen that modifies guanine so that is mispairs with adenine when adenine is in the template DNA strand during DNA replication.However, this mispairing is limited to when the modified guanine is being added to the newly replicating DNA strand.When the modified guanine is in the template DNA strand it always pairs normally with cytosine being added to the growing newly-synthesized strand.What type of mutation would you predict would be caused by the new chemical mutagen?


A) A-to-G base substitutions
B) A-to-C base substitutions
C) A-to-T base substitutions
D) A-to-G and A-to-C base substitutions
E) G-to-T base substitutions

F) A) and B)
G) A) and C)

Correct Answer

verifed

verified

What would be the result of a large deletion in the resolvase gene of a transposable element?

Correct Answer

verifed

verified

Resolvase is an enzyme carried by some t...

View Answer

What is the consequence of a transversion mutation in duplex DNA?


A) A purine is replaced by a pyrimidine, and a pyrimidine is replaced by a purine.
B) A base pair is lost within the DNA of a gene, which causes a reading frameshift.
C) A purine is replaced by another purine, and a pyrimidine is replaced by another pyrimidine.
D) A base pair is added to the DNA within a gene, which causes a reading frameshift.
E) The sequence of the DNA remains the same since the change involves proteins.

F) A) and B)
G) B) and D)

Correct Answer

verifed

verified

The mutagen EMS converts guanine (G)to O-6-ethylguanine (G*).O-6-ethylguanine (G*)forms base pairs with thymine (T)instead of cytosine (C).Suppose that exposure to EMS damages a DNA molecule as shown below. The mutagen EMS converts guanine (G)to O-6-ethylguanine (G*).O-6-ethylguanine (G*)forms base pairs with thymine (T)instead of cytosine (C).Suppose that exposure to EMS damages a DNA molecule as shown below.   Characterize the mutation induced by EMS as a transition, transversion, or frameshift. Characterize the mutation induced by EMS as a transition, transversion, or frameshift.

Correct Answer

verifed

verified

The mutati...

View Answer

Which of the following CORRECTLY describes nonsense mutations?


A) They cause a nonfunctional amino acid to replace a functional amino acid.
B) They change the nucleotide sequence of a gene but do not change the sequence of the resulting protein.
C) They result in the insertion or deletion of a small number of nucleotides to the DNA.
D) They convert a codon for a particular amino acid within a gene into a stop codon.
E) They cannot revert or back-mutate to wild-type.

F) C) and E)
G) B) and D)

Correct Answer

verifed

verified

Ultraviolet light causes what type of DNA lesion?


A) Large deletions
B) Deaminated cytosines
C) Pyrimidine dimers
D) Mismatch bases
E) Depurinations

F) C) and D)
G) A) and D)

Correct Answer

verifed

verified

Upon transposing to a new site, transposable elements:


A) add methyl groups to bases of the surrounding DNA.
B) delete about 100 base pairs of DNA on each side of them.
C) duplicate their transposase gene.
D) express a gene that confers sensitivity to some common antibiotics.
E) create a duplication of a target sequence on each side of them.

F) C) and E)
G) B) and D)

Correct Answer

verifed

verified

Why do insertions and deletions often have more drastic phenotypic effects than do base substitutions?

Correct Answer

verifed

verified

Insertions and deletions can change read...

View Answer

Consider two theoretical transposable elements in yeast, A and B.Each contains an intron and each transposed to a new location in the yeast genome.Suppose you then examine the transposons for the presence of the intron.In the new locations, you find that A has no intron but B does.From these facts, what can you conclude about the mechanisms of transposition for the two transposable elements?


A) B probably makes a transposase.
B) A probably has inverted repeats at each end of the element.
C) B probably uses RNA as an intermediate in the transposition event.
D) B probably makes a reverse transcriptase.
E) A probably doesn't create a duplication of the host genome target sequence.

F) A) and C)
G) C) and E)

Correct Answer

verifed

verified

A _____ mutation changes a codon that specifies an amino acid into one that terminates translation.


A) missense
B) nonsense
C) silent
D) neutral
E) reverse

F) B) and E)
G) None of the above

Correct Answer

verifed

verified

Showing 41 - 60 of 76

Related Exams

Show Answer